Absence of Emerging GVIII IBV Genotypes IB80 and D2860 in Iranian Poultry: Molecular Surveillance From 2022–2025

1. Introduction
Infectious bronchitis virus (IBV), a member of the Gammacoronavirus genus (Coronaviridae family), poses a significant global threat to poultry health and productivity. The virus targets respiratory, renal, and reproductive tissues in chickens, causing substantial economic losses through reduced egg production, impaired weight gain, and heightened susceptibility to secondary pathogens [1]. IBV exhibits extraordinary genetic plasticity, driven by high mutation rates, recombination events, and large population sizes. This rapid evolution continually generates novel antigenic variants that evade cross-protective immunity, complicating control efforts and necessitating vigilant molecular surveillance [2-4].
Accurate strain detection is critical for IBV management. While serological assays (e.g. enzyme-linked immunosorbent assay [ELISA], Hemagglutination Inhibition [HI]) remain widely used, their limitations in sensitivity and specificity impede reliable variant identification [5]. Molecular approaches—particularly reverse transcription–polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), and next-generation sequencing (NGS)—now enable precise genotyping and real-time tracking of emerging lineages, forming the cornerstone of modern IBV epidemiology [2-4].
Recent European surveillance has revealed the expansion of genotype VIII (GVIII) strains, a phylogenetically distinct group first proposed by Domanska-Blicharz et al. (2020) [6]. These strains showed less than 58.1% nucleotide identity with previously known IBV genotypes and the highest similarity (81.4% identity) to the unique North American PA/1220/98 variant [7-10]. Notably, IB80-like strains (e.g. CK/DE/IB80/2016) have been detected more than 220 times across European poultry farms since 2015, with sporadic reports from the Middle East and the Philippines [11]. The Dutch strain D2860, recently characterized from layer locks, shares 95% whole-genome identity with IB80, confirming their close relationship within GVIII [12]. Both variants exhibit pronounced tropism for layer and breeder flocks, with minimal detection in broilers—a host-specific pattern consistent with certain IBV lineages [13].
In Iran, endemic IBV genotypes—including variant 2 (IS/1494-like), 793/B, and QX—dominate outbreaks in broilers and breeders [14, 15]. Despite the rapid transcontinental spread of GVIII strains, their presence in Iranian poultry remains uninvestigated. This knowledge gap is critical given Iran’s strategic location within Eurasian poultry trade routes and the economic consequences of the incursion of novel variant.
This study bridges this gap through targeted molecular surveillance of the emergent GVIII strains IB80 and D2860 in Iranian broiler and broiler breeder flocks (2022–2025). Our findings inform regional vaccine strategies and contribute to global efforts to track IBV evolution.

2. Materials and Methods
2.1. Study design and sample collection
A retrospective study was conducted from 2022 to 2025 to investigate respiratory disease complexes in Iranian poultry farms. A total of 200 samples were collected from clinically affected flocks in different provinces of Iran (Gilan, Mazandaran, Fars, Kurdistan, Qazvin, Khuzestan, Isfahan, Khorasan, and Azarbaijan), comprising 140 samples from broiler chickens and 60 samples from broiler breeder flocks. Sample selection was based on the presence of clinical signs consistent with respiratory infection, including coughing, nasal discharge, respiratory distress, and decreased production performance. Postmortem tissue samples were obtained from affected birds, specifically targeting the trachea, lungs, and associated respiratory tissues. Each sample was aseptically placed into sterile tubes and immediately stored at -80 °C to preserve RNA integrity for subsequent molecular analyses.

2.2. RNA extraction and cDNA synthesis
Total RNA was extracted from tissue samples using the SinaPure RNA Extraction kit (Cinagen, Iran) according to the manufacturer’s protocol [16]. RNA purity and concentration were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) by measuring absorbance ratios at 260/280 nm and 260/230 nm. cDNA synthesis was performed using a commercial reverse transcription kit (Thermo Fisher Scientific, USA). Each reaction contained 1 μg of RNA, reverse transcriptase enzyme, reaction buffer, random primers, and dNTPs in a total volume of 20 μL. The reaction conditions were as follows: 25 °C for 10 minutes, 42 °C for 60 minutes, followed by enzyme inactivation at 70 °C for 10 minutes.

2.3. Polymerase chain reaction amplification and detection
Specific PCR assays were previously developed to detect IB80 and D2860 variants of infectious bronchitis virus [11, 12]. Two separate PCR reactions were performed for each sample using distinct primer sets targeting different regions of the spike gene. The first primer set (IB80 F1: TACTGGTAATTTTACAGATGG; IB80 R1: TAATTTGCTTACAGGCACC) and the second set (D2860 F2: GTAGCACCCACTAAGTTGCC; D2860 R2: TGTAATTGAACCATTAGCAC) were used in parallel reactions [11, 12].
Each 25 μL PCR reaction contained 12.5 μL of 2X PCR Master Mix (Promega, USA), 1 μL of each forward and reverse primer (10 μM), 2 μL of cDNA template, and nuclease-free water to reach the final volume. Amplification was performed under the following conditions: initial denaturation at 95 °C for 5 minutes; 35 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and extension at 72 °C for 45 seconds; followed by a final extension at 72 °C for 10 minutes.

2.4. Electrophoresis and visualization
PCR products were analyzed by electrophoresis on 1.5% agarose gels containing ethidium bromide (0.5 μg/mL) in 1X TAE buffer at 100 V for 45 minutes. A 100-bp DNA ladder (Thermo Fisher Scientific, USA) was included as a molecular size standard. DNA bands were visualized under UV light using a transilluminator (Bio-Rad, USA) and documented using a gel imaging system.

2.5. Quality control measures
Each PCR run included appropriate positive and negative controls. The positive control consisted of cDNA from a known positive sample, while the negative control contained nuclease-free water instead of the template. Sample integrity was verified by successful amplification of housekeeping genes in parallel reactions. The specificity of amplification was confirmed by the expected product sizes for each primer set and the absence of bands in the negative controls.

3. Results
Molecular screening of 200 clinical samples (140 from broilers and 60 from broiler breeders) using two specific RT-PCR primer sets targeting the IB80 and D2860 hypervariable regions of S1 subunit of the spike gene failed to detect either strain in any tested specimens. Electrophoretic analysis of PCR products revealed no amplification bands at the expected sizes of 412 bp (primer set 1) or 389 bp (primer set 2) across all samples. Control reactions performed alongside the experimental samples demonstrated proper assay function, with positive controls yielding bands of the correct size and no-template controls showing no amplification.
The consistent negative results across all samples from clinically affected flocks suggest two plausible explanations. First, these genotype VIII variants may have been absent from the surveyed Iranian poultry populations during the 2022-2025 study period. Second, viral loads in respiratory tissues may have been below our assay’s detection limit of 100 RNA copies per microliter, as determined through serial dilution of positive control material. The confirmed sensitivity and specificity of our primers, combined with the inclusion of flocks exhibiting clear respiratory disease symptoms, support the conclusion that IB80 and D2860 were not major causative agents of infectious bronchitis in these populations during our investigation.

4. Discussion
This study provides the first targeted molecular evidence for the absence of emergent genotype VIII (GVIII) IBV strains IB80 and D2860 in Iranian poultry flocks exhibiting clinical respiratory disease (2022–2025). This finding is epidemiologically significant given the rapid transcontinental spread of antigenically distinct GVIII lineages across Europe (more than 220 detections since 2015) and their documented expansion into the Middle East [11]. While suggesting potential geographic compartmentalization, we acknowledge the following limitations: cryptic circulation below detection thresholds or in unsampled host populations cannot be excluded.
The IBV genotypic stability in the current study (absence of GVIII variants) contrasts sharply with the epidemiology of IBV variants in Europe, where GVIII lineages continue to emerge. The dominance of variant 2 may impose competitive exclusion against invading strains through pre-existing population immunity or niche occupation. Historically, Iran has reported circulation of several IBV genotypes, including 793/B, QX, Massachusetts, D274, Q1, and IS/1494-like strains [14, 15, 18-20]. The IS-1494-like IBV genotype was the most common type accounting for 85% of detected strains from nine provinces of Iran in 2017. The other types accounted for smaller proportions; including 793/B with a prevalence of 7%, QX, and Massachusetts with prevalence rates of 5% and 2%, respectively, and D274 with a prevalence of 1% [15]. In the eastern part of the country, variant 2 (IS/1494-like) was predominant, followed by the 793/B and QX genotypes [21]. A large-scale study between 2010 and 2014 identified seven genotypically distinct IBV lineages: Mass, 793/B, IS720, variant 2, QX, IR-I, and IR-II, among which vaccine-related variants were less prevalent [22]. QX-like viruses were found in 48% of infected flocks with respiratory signs in southwestern Iran [14].
The selective absence of IB80 and D2860 in our cohort, which included flocks with overt clinical signs, may also reflect the host tropism reported in European studies. These variants were predominantly detected in layer and breeder flocks, with limited presence in broilers [6, 13]. Although 60 broiler breeder samples were included in our analysis, further targeted surveillance of egg-laying systems may be warranted to rule out silent circulation.

​​​​​​​5. Conclusion 
While GVIII strains currently pose no detectable threat to Iranian broiler production, their rapid European expansion necessitates proactive surveillance. Integrating phylogenomic monitoring, host-specific sampling, and environmental risk modeling will be essential for early detection. This study establishes a critical baseline for tracking IBV incursions in a strategically significant region. 

Acknowledgements
We gratefully acknowledge Reza Esmaleezadeh Dizaji for providing the positive cDNA samples used in this study.

Compliance with ethical guidelines
There were no ethical considerations to be considered in this research.

Funding
This research did not receive any grant from funding agencies in the public, commercial, or non-profit sectors.

Authors' contributions
Conceptualization and study design: Arash Ghalyanchilangeroudi and Hossein Hosseini; Analysis and data interpretation: Arash Ghalyanchilangeroudi and Zahra Ziafati Kafi; Writing the original draft: Soroush Sarmadi, Alireza Bakhshi, Fahime Jamiri, Ghazal Daghayeghi, Nazanin Sarvian, Mahtab Heydarpour, and Erfan Khakpour; Data acquisition: Amitis Sadighi, Seyed Mani Mehrnia, and Seyed Alireza Rezaee; Review and editing: Rima Morshed and Hossein Hosseini; Supervision: Arash Ghalyanchilangeroudi.

Conflict of interest
The authors declared no conflict of interest.

Data availability
The data that support the findings of this study are available upon request from the corresponding author. 

References

1. Jackwood M, de Wit S. Infectious bronchitis. In: Swayne DE, McDougald LR, Nair V, Suarez DL, editors. Diseases of Poultry.Hoboken, NJ: Wiley-Blackwell; 2020. [DOI:10.1002/9781119371199.ch4]
2. Jackwood MW, Hall D, Handel A. Molecular evolution and emergence of avian gammacoronaviruses. Infect Genet Evol. 2012; 12(6):1305-11. [DOI:10.1016/j.meegid.2012.05.003] [PMID]
3. Sjaak de Wit JJ, Cook JK, van der Heijden HM. Infectious bronchitis virus variants: A review of the history, current situation and control measures. Avian Pathol. 2011; 40(3):223-35.[DOI:10.1080/03079457.2011.566260] [PMID]
4. de Wit JJS, Cook JKA. Spotlight on avian pathology: Infectious bronchitis virus. Avian Pathol. 2019; 48(5):393-5. [DOI:10.1080/03079457.2019.1617400] [PMID]
5. Cavanagh D. Coronavirus avian infectious bronchitis virus. Vet Res. 2007; 38(2):281-97. [DOI:10.1051/vetres:2006055] [PMID]
6. Domanska-Blicharz K, Lisowska A, Sajewicz-Krukowska J. Molecular epidemiology of infectious bronchitis virus in Poland from 1980 to 2017. Infect Genet Evol. 2020; 80:104177.[DOI:10.1016/j.meegid.2020.104177] [PMID]
7. Kingham BF, Keeler CL Jr, Nix WA, Ladman BS, Gelb J Jr. Identification of avian infectious bronchitis virus by direct automated cycle sequencing of the S1 gene. Avian Dis. 2000; 44(2):325-35. [DOI:10.2307/1592547] [PMID]
8. Gelb J Jr, Weisman Y, Ladman BS, Meir R. S1 gene characteristics and efficacy of vaccination against infectious bronchitis virus field isolates from the United States and Israel (1996 to 2000). Avian Pathol. 2005; 34(3):194-203.[DOI:10.1080/03079450500096539] [PMID]
9. Valastro V, Holmes EC, Britton P, Fusaro A, Jackwood MW, Cattoli G, et al. S1 gene-based phylogeny of infectious bronchitis virus: An attempt to harmonize virus classification. Infect Genet Evol. 2016; 39:349-64. [DOI:10.1016/j.meegid.2016.02.015] [PMID]
10. Ma T, Xu L, Ren M, Shen J, Han Z, Sun J, et al. Novel genotype of infectious bronchitis virus isolated in China. Vet Microb. 2019; 230:178-86. [DOI:10.1016/j.vetmic.2019.01.020] [PMID]
11. Petzoldt D, Vogel N, Bielenberg W, Haneke J, Bischoff H, Liman M, et al. IB80-A novel infectious bronchitis virus genotype (GVIII). Avian Dis. 2022; 66(3):1-8. [DOI:10.1637/aviandiseases-D-22-00020] [PMID]
12. Molenaar RJ, Dijkman R, Jorna I, de Wit JJ. Extensive genetic and biological characterization of infectious bronchitis virus strain D2860 of genotype GVIII. Avian Pathol. 2024; 53(5): 380-9. [DOI:10.1080/03079457.2024.2338801] [PMID]
13. Vermeulen CJ, Dijkman R, de Wit JJS, Bosch BJ, Heesterbeek JAPH, van Schaik G. Genetic analysis of infectious bronchitis virus (IBV) in vaccinated poultry populations over a period of 10 years. Avian Pathol. 2023; 52(3):157-67. [DOI:10.1080/03079457.2023.2177140] [PMID]
14. Boroomand Z, Jafari RA, Mayahi M. Molecular detection and phylogenetic properties of isolated infectious bronchitis viruses from broilers in Ahvaz, southwest Iran, based on partial sequences of spike gene. Vet Res Forum. 2018; 9(3):279-83. [DOI:10.30466/vrf.2018.32089] [PMID]
15. Ghalyanchilangeroudi A, Hosseini H, Fallah Mehrabadi MH, Ghafouri SA, Modiri Hamdan A, Ziafati Z, et al. Genotyping of avian infectious bronchitis virus in Iran: Detection of D274 and changing in the genotypes rate. Comp Immunol Microbiol Infect Dis. 2019; 65:110-5. [DOI:10.1016/j.cimid.2019.05.011] [PMID]
16. SinaPure RNA extraction kit. Tehran: SinaClon; 2026. [Link]
17. Saadat Y, Bozorgmehri Fard MH, Charkhkar S, Hosseini H, Shaikhi N, Akbarpour B. Molecular characterization of infectious bronchitis viruses isolated from broiler flocks in Bushehr province, Iran: 2014 - 2015. Vet Res Forum. 2017; 8(3):195-201. [PMID]
18. Mousavi FS, Ghalyanchilangeroudi A, Hosseini H, Nayeri Fasaei B, Ghafouri SA, et al. Complete genome analysis of Iranian IS-1494 like avian infectious bronchitis virus. Virusdisease. 2018; 29(3):390-4. [DOI:10.1007/s13337-018-0462-4] [PMID]
19. Kalokhoran AY, Ghalyanchilangeroudi A, Hosseini H, Madadgar O, Karimi V, Hashemzadeh M, et al. Co-circulation of three clusters of 793/B-like avian infectious bronchitis virus genotypes in Iranian chicken flocks. Arch Virol. 2017; 162(10):3183-9. [DOI:10.1007/s00705-017-3473-3] [PMID]
20. Ghalyanchilangeroudi A, Najafi H, Fallah Mehrabadi MH, Ziafati Kafi Z, Sadri N, Hojabr Rajeoni A, et al. The emergence of Q1 genotype of avian infectious bronchitis virus in Iran, 2019: The first report. Iran J Vet Res. 2020; 21(3):230-3. [PMID]
21. Ghalyanchilangeroudi A, Karimi V, Janat A, Hashemzadeh M, Fallah Mehrabadi MH, Gholami F, et al. Genotyping of infectious bronchitis virus in the East of Iran, 2015. Iran. J. Virol. 2015; 9 (2):31-5. [DOI: DOI:10.21859/isv.9.2.31
22. Hosseini H, Fard MH, Charkhkar S, Morshed R. Epidemiology of avian infectious bronchitis virus genotypes in Iran (2010-2014). Avian Dis. 2015; 59(3):431-5. [DOI:10.1637/11091-041515-ResNote.1] [PMID]