Identification of yeast species from uncultivated soils by sequence analysis of the hypervariable D1/D2 domain of LSU–rDNA gene in Kermanshah province, Iran

INTRODUCTION

Yeasts are a polyphyletic group of ascomycete and basidiomycetous fungi characterized by having a unicellular growth phase and sexual stages that are not enclosed in fruiting bodies (Kurtzman & Fell 1998). Most yeasts are saprotrophs that assimilate plant or animal–derived organic compounds. Yeasts are usually decomposers, however, some species are pathogens of plants and animals. They facilitate production of fermented foods and alcoholic beverages, production of secondary metabolites, vitamins, organic acids, carotenoid and recombinant vaccine (Hierro et al. 2004). A large number of yeasts catabolize benzene compounds which may ease cleaning up spills of industrial chemicals and human friendly biosynthesized new compounds (Middelhoven 1993). Kurtzman and Fell (1999) reported approximately 100 genera of yeasts comprising more than 700 species have been identified which is less than 1% of the world species. Many yeasts are isolated from soils and have cosmopolitan distribution which spray them in both natural and artificial substrates (Phaff et al. 1966, Spencer & Spencer 1997).

Some species, including Debaryomyces (Schwanniomyces) occidentalis, Lipomyces spp., Schizoblastosporion starkeyihenricii, Cryptococcus and certain Rhodotorula and Sporobolomyces species, are isolated exclusively from soils (Hagler & Ahearn 1987). The occurrence of yeasts in the soil has been studied in various parts of the world (Jensen 1963, Vishniac 1996, Dmitriev et al.1997). Slavikova and Vadkertiova (2000) showed that Cryptococcus laurentii, Cystofilobasidium capitatum, Leucosporidium scottii, Rhodotorula aurantiaca, and Trichosporon cutaneum were the most frequently isolated species from the samplestaken in soil forest of Slovakia.

Intensive researches on diversity of yeasts in extreme environments have been conducted (Gadanho et al. 2006, Nagahama et al. 2001, Tosi et al. 2002). Mok et al. (1984) and Baublis et al. (1991) isolated yeasts from tropical and Antarctic soils respectively. Connell et al. (2006) studied the distribution and abundance of yeasts in Antarctica soil from Taylor Valley. The diversity of microorganisms is the building block of the ecological balance of the biosphere (Slavikova & Vadkertiova 2000). Monitoring fungal diversity has been fundamental to the increased interest of microbiological functions. Yeasts are important members in many ecosystems and form a significant contribution to the biodiversity (Fleet, 1998).

The soil is the ultimate repository to store and develop of certain species of yeasts (Phaff and Starmer 1987). An accurate identification of species in the ecosystem and proper molecular tools are necessary factors to determine the validity of studies in yeast ecology (Kurtzman & Fell 2006).

The correct identification of yeasts is not always easy and morphology does not suffice to distinguish those fungal species which have very few discernible morphological traits. Identification of yeasts species is traditionally carried out by help of morphological and physiological traits (Kurtzman & Fell 1998) or by biochemical techniques (Barnett et al. 2000). These criteria are poorly sufficient for species with very similar morphological features and difficult to identify at the species level (Deak & Beuchat 1996). Conventional yeast identification based on phenotypic characteristics is often misleading and inconclusive, and usually needs to be corroborated by molecular methods. DNA–DNA hybridization (Vaughan Martini & Martini 1987, Torok et al. 1993), electrophoretic karyotyping (Vezinhet et al. 1990, Guillamon et al. 1996) and RFLPs of chromosomal DNA (Versavaud & Hallet 1995) tools have been developed to identify and characterize yeast species however have become less popular compared to other faster and easier molecular techniques. Within these molecular techniques, PCR based methods have permit both intra–species differentiation and species identification of yeast isolates (de Barros Lopes et al. 1998).

Mokhtarnejad et al (2015a) introduced 25 species of basidiomycete yeasts from soil of Iran. They also recorded six new species of ascomycete yeasts such as (Meyerozyma guilliermondii, Metschnikowia sinensis, Debaryomyces hansenii, D. subglobosus, Torulaspora delbrueckii and Candida baotianensis) that isolated in hypersaline soils of Urmia Lake basin (North West of Iran) (Mokhtarnejad et al. 2015b).In other study, Mokhtarnejad et al. (2016) showed that Solicoccozyma aeria is the dominant yeast species in hypersaline soils of Urmia Lake National Park (Mokhtarnejad et al. 2016).Also, twenty–one species belonging to the genera Cystobasidium, Holtermanniella, Naganishia, Rhodotorula, Saitozyma, Solicoccozyma, Tausonia, Vanrija, and Vishniacozyma isolated and identified from this area.

This study was aimed to identify yeast strains present in uncultivated soils using molecular methods and evaluation of environmental parameters on their distribution.

MATERIALS AND METHODS

Sample collection and soil analysis

Twenty five soil samples (five soil sub–samples from each area were collected and mixed) were collected from 5–10 cm depth, sieved 2 mm, 40 and 60 mesh sieves in Kermanshah province (Fig 2). Soil texture was analyzed using Gee and Bauder (1986) method. pH of each sample was measured after preparation of soil suspension (one gram of soil to five mL deionized water) using pH meter (Thomas 1996) and total soluble salts measured using electrical conductivity meter (Rhoades 1996).

Isolation of yeasts

According to the procedure is described in Waksman & Fred, 1922) ten g of soil samples were placed in 90 mL of 0.1% water-–agar containing 100 ppm NPX (Nonylphenyl polyethylene glycol ether containing a concentration of 10.5 moles of ethylene oxide), mixed and serially diluted to 10^–2 to 10^–5 and 1 mL of each solution flooded on yeast extract malt extract agar (YM agar). Yeast malt agar prepared by adding 3 g yeast extract, 3 g malt extract, 5 g peptone, and 10 g glucose to one liter of distilled water. These media were amended with HCl (0.7 ml.L^–1) and chloramphenicol (0.1g.L^–1). Plates were incubated at 25–27 ºC for 3–5 days for a fine colony development. Morphological properties were determined for each isolate using Yamamoto et al. (1991) methods. The production of pigments and shape of colonies of yeast was examined.

Molecular identification

DNA extraction

The isolates were grown for approximately 24 h at 25 °C in YM medium. For each isolate, one loop of cells suspended in 100 µL distilled water and heated for 5 min at 99 °C (Suhet al., 2008). The DNA extraction was performed using the methods described by Suhet al. (1998). The amount of DNA obtained was estimated by a NanoDrop spectrophotometer (CARY100 scan Varion, Australia).

DNA amplification and sequencing

The D1/D2 domain at the 5^' end of the LSU rRNA gene was symmetrically amplified with primers NL–1 (5^'–GCATATCAATAAGCGGAGGAAAAG–3^') and NL–4 (5^'–GGTCCGTGTTTCAAGACGG–3^') (O^'Donell, 1993, Kurtzman & Robnet, 1998). Amplifications were performed in a T–Personal thermocycler (Biometra, Germany). The PCR mixture contained: 10–20 ng of template DNA, 1 μM of each primer, 100 μM of dNTPs, 0.4 U Taq DNA polymerase (CinnaGen, Iran), 1.5 mM of MgCl₂, 2.5 μL of 10X PCR buffer in a reaction volume of 25 μL. All PCRs consisted of 1 cycle of 95 °C for 5 min; 35 cycles of 95 °C for 1 min, 55.5 °C for 2 min, 72 °C for 2 min; and a final cycle of 72 °C for 10 min. Successful amplification was confirmed by gel electrophoresis (1 h at 80 Volts) on 1.0% agarose gels in 1X TBE buffer. Gels were stained using ethidium bromide and DNA fragments were visualized under UV light.

Sequencing of PCR product

The amplification products of all specimens were purified through GenJET PCR purification kit (Fermentas, UK) to remove excess primers and nucleotides. PCR products were sequenced (Tech Dragon, Hong Kong) in forward and reverse orientation using the primers used for amplification and a dye terminator cycle sequencing kit (BigDye sequencing kit, Applied Biosystems, USA) on an ABI377–96 automated sequencer (Applied Biosystems, USA) according to the manufacturer's instruction. All sequences of the D1/D2 domain of the LSU–rDNA gene deposited at the GenBank (NCBI, http://www.ncbi.nlm.nih.gov/Entrez) (Bethesda, MD, USA).

Phylogenetic analysis

Closest matches to each sequence were determined using the BLASTN sequence similarity search tool in GenBank (Altschul et al. 1997, Thompson et al. 1997). Multiple alignments were performed with CLUSTAL W (Thompson et al. 1996) using default settings and were manually optimized with BIOEDIT v.7.0.9 (Hall 1999). Phylogenetic analyses were performed with Mega 4 (Kumar et al. 2004) using maximum parsimony (MP) and neighbor–joining (NJ) with the Kimura 2–parameter (K2P) model. The complete deletion method was employed in gap handling for all alignment sites. All sites containing alignment gaps were removed from the analysis before calculations and then treated as missing data. The confidence of branching was assessed by computing 500 bootstrap re–samplings (Felsenstein 1985). The final tree and matrix of sequences were submitted to TreeBASE (University at Buffalo, USA; http://www. treebase.org).

 Statistical analysis

Canonical correspondence analysis (CCA) was used to examine the significance of soil texture, soil pH, total soluble salt and elevation on the distribution and abundance of yeast genotypes in different areas of Kermanshah province using CANOCO software 4.5 (Microcomputer Power, Ithaca, NY, USA). Soil parameters were tested for significant differences between the sites using Turke^y’s Post Hoc Test.

RESULTS

Soil analysis

The results of physico–chemical analyses on soil samples of different areas of Kermanshah province are shown in Table 1. Statistical analysis using Tukey’s Post Hoc Test showed differences in soil structure parameters and amount of EC and pH among sites. The collected soils were mostly in sandy, loamy sand and alkaline pH. These soils were considered as basic and non–saline soils.

Environmental parameters

The relative importance of the determined environmental parameters to the distribution of yeasts in different areas of Kermanshah province is illustrated in CCA biplot (Fig. 1) where environmental parameters and yeasts are arranged on the basis of their scores on two axes. The relative position of the arrows reflects the relationship of the axes with the environmental parameters. Eigenvalues for axes 1 and 2 were 0.2and 0.69, respectively.

Table 1. Sources, GPS information and physico–chemical parameters of soil samples from different areas of Kermanshah province, Iran