طراحی، سنتز و ارزیابی in vivo یک کاندید واکسن ساختار اپیتوپی فیوژن بر اساس قطعات Na, HA2, HA1, M2e و NP ویروس آنفلوانزای پرندگان H5N1 با بیماری زا بالا | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Archives of Razi Institute | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Article 23, Volume 79, Issue 4, January and February 0, Pages 849-856 PDF (313.96 K) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Document Type: مقالات پژوهشی | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| DOI: 10.32592/ARI.2024.79.4.849 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Abstract | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| زیرگروه H5N1 ویروس آنفولانزا، بیماری زایی و کشندگی بسیار بالایی در انسان و حیوان دارد و نیاز به ساخت واکسن های جدید با طیف وسیعی از اثرات بر علیه این پاتوژن بسیار حیاتی به نظر می رسد. امروزه، یک راه حل بسیار مورد توجه برای این مشکل، طراحی و تولید واکسن های نوترکیب با استفاده از پپتید حفاظت شده ویروس های آنفلوانزا است. با جستجو در پایگاههای اطلاعاتی بینالمللی، توالی پپتیدی قطعه M2e ویروس H5N1 جدا شده از ایران و انواع توالیهای پپتیدی حفاظتشده قطعات HA1، HA2، NA و NP سایر ویروسهای H5N1 برای هر دو گیرنده MHC در موش به دست آمد. سپس این قطعات به همراه یک توالی PADRE توسط برنامه های بیوانفورماتیک برای طراحی یک ساختار اپیتوپی فیوژن متصل شدند. سپس سازه طراحی شده برای بیان در E.coli BL21 بهینه شد. پس از بیان، و خالص سازی ساختار اپیتوپی فیوژن، آن را به صورت زیر جلدی (SC) به عضلات اندام عقبی موش ماده BALB/c هفته 6-8 تزریق شد. سه هفته پس از پایان ایمن سازی دوم، هر دو گروه موش واکسینه شده و موش کنترل وزن شدند و از نظر عوارض جانبی در محل تزریق بررسی شدند. در نهایت موش ها معدوم شدند و خون از قلب آنها برای تعیین آنتی بادی IgG کل قبل و بعد از ایمن سازی با روش الایزا جمع آوری شد. هیچ التهاب موضعی یا عارضهای در محلهای تزریق SC تا پایان آزمایش مشاهده نشد و کالبد شکافی موشها هیچ خونریزی یا ضایعهای در اندامها بهویژه کبد و طحال نشان نداد. وزن موش ها در طول دوره ایمن سازی تغییر قابل توجهی نداشت. سطح کل IgG اندازهگیری شده با میانگین OD در سرم موشهای ایمنسازی شده، پنج برابر بیشتر (5.881 نانوگرم در میلیلیتر) در مقایسه با گروه کنترل (1.143 نانوگرم در میلیلیتر) نشان داد. نتایج ما پاسخ آنتی بادی IgG بسیار قابل توجهی را پس از تجویز SC پپتید نوترکیب ایمونوژنیک در موش نشان داد. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Keywords | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ویروس آنفلوانزا; H5N1; ساختار اپیتوپی فیوژن; واکسن; IgG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Full Text | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Since the initial influenza pandemic, influenza viruses have remained the most important respiratory pathogen in humans and one of the most critical pathogens in the livestock and poultry industry (1). It is estimated that between 10 and 20 percent of the world population is affected by seasonal influenza epidemics every year. Of these, between three and five million individuals experience severe disease and 250,000 to 500,000 die yearly (2). In the livestock and poultry industry, infection from influenza viruses causes significant damage every year, which poses a considerable risk to the global health system (3). The classification of influenza viruses is within the Orthomyxoviridae family and include four genera: Alpha, Beta, Gamma, and Delta influenza viruses, or A Influenzavirus, B Influenzavirus, C Influenzavirus, and D Influenzavirus (4). Of the four genera, only types A, B and C have been demonstrated to be pathogenic in humans, while the pathogenicity of genus D has never been reported in humans (4). The most crucial group of influenza viruses is Type A, which is classified into 198 subtypes based on two types of surface proteins: Hemagglutinin (HA) and Neuraminidase (NA). The genome of Type A influenza virus is a single-stranded RNA (ssRNA), negative sense, fragmented into eight segments (4). Recombination between these segments is responsible for the emergence of new influenza virus subtypes during the replication process. In addition, spot mutations of influenza viruses contribute to the development of resistance to vaccines and drugs, with a high prevalence (4). Currently, all influenza vaccines use the viral HA protein to elicit immunity during infection. he traditional method of producing the influenza vaccine involves culturing the virus in hatched eggs. However, other methods are also being developed, including the cultivation of the virus in cell lines and the expression of antigenic fragments by a range of other organisms, including viruses, bacteria, yeasts, algae, and plants (5, 6). Given the considerable number of influenza virus subtypes that are currently in circulating among humans and animals, influenza vaccines are generally available in trivalent or quadrivalent vaccine formulations. However, due to the unpredictable nature of the subtypes responsible for the influenza virus pandemics and the mutations in the HA protein, the effectiveness of these vaccines is limited, and they are only usable for six months (7). In contrast to the HA protein of influenza viruses, which is highly variable and undergoes frequent mutation, genomic areas have been identified in influenza viruses that are highly conserved. These areas and can be used to design and develop vaccines which are potentially more effective and induce long-lasting protective immunity in the host (8). The most notable of these regions is the outer piece of the protein matrix two, denoted as M2e, which exhibits a striking degree of conservation across diverse influenza virus strains. The 23 amino acids comprising the M2e sequence display remarkable uniformity, with minimal variation observed across different influenza viruses. One of the different influenza virus subtypes that is commonly found in both humans and animals and can cause severe disease and high human mortality rates in humans is the H5N1 subtype. This subtype is classified as HPAI (High Pathogenic Avian Influenza) in birds. According to the World Health Organization (WHO), this subtype may potentially cause an influenza pandemic in humans in the future. The most advanced technology for the preparation of influenza vaccines is the production of immunogenic peptide components of viruses in microorganisms using recombinant DNA technology. In recent years, there has been a great deal of interest and attention directed towards the utilization of conserved epitopic sequences of antigenic proteins of influenza viruses. Matrix protein 2 (M2e) sequences and peptide components derived from nucleoprotein (NP) and neuraminidase (NA) proteins of the influenza virus can be used to generate recombinant peptide vaccines that elicit more significant and more prolonged immunity and effectiveness (9). Therefore, in the present study we designed and developed a multi-epitopic recombinant peptide vaccine based on M2e, HA1, HA2, NA and NP proteins of H5N1 subtype and evaluated its immunogenicity in BALB/c mice.
2.1. M2e Sequence Selection A search of By searching the flu virus databases including GISAID, BV-BRC and NCBI revealed that, it was found that so far seven strains of HPAIV H5N1 influenza virus isolated from swans, chickens and ducks from Iran between 2006 and 2017 have been registered in the global flu virus databases. However, only three of the strains contain the M2 gene sequence, specifically the region between amino acids 2 and 24 of the M2 protein, whichis commonly referred to as the M2e region. The M2e sequences of three Iranian H5N1 influenza viruses were aligned using the T-COFFEE program (Barcelona, Spain). It was found that the two sequences exhibited complete similarity, while the third sequence differed by a single amino acid. Furthermore, the sequences were also aligned with the M2e sequences of the four international vaccine strains of the H5N1 virus. It was found that the amino acid sequences of two Iranian strains and three vaccine strains were completely identical. Accordingly, the M2e sequence of Iranian H5N1 strains exhibited 100% similarity to H5N1 vaccine strains was employed in this study (Figure 1). 2.2. The Selection of Conserved H5N1 Epitopic Sequences from HA1, HA2, NA, and NP Proteins with High Affinity Binding to Mice MHC Class I and II Molecules The conserved epitopic sequences were derived from HA1, HA2, NA, and NP proteins of the H5N1 influenza virus and were selected from the IEDB and BV-BRC databases for both MHC class I and II receptor types in mice, which are Kd (equivalent to MHC I) and IAd (equivalent to MHC II) (Table 1). 2.3. Design and In Silico Computational Analysis of Fusion Epitopic Construct Vaccine The amino acid sequences of the selected epitopes that are to be used to design the vaccine must bind together, and this requires the use of amino acid sequences called linkers, which are different for each epitopic receptor. The linker sequences corresponding to the H5N1 peptide are listed in Figure 2. The amino acid sequence of the epitopic fragments and linkers were edited using the SnapGene program (version 5, Boston, USA),followed by the ProtParam program (version 10, Boston, USA) to examine the physical and chemical properties needed to peptide expression. It was determined that the designed peptide exhibited the required properties for expression. Peptide DNA sequences designed for expression in E.coli bacteria were optimized for codons using the Jcat program (Braunschweig, Germany).The resulting sequence was synthesized for expression. An 18-piece peptide was obtained, consisting of 3 M2e sequences, a PADRE sequence, 7 IAd epitopic sequences, and 7 Kd epitopic sequences.It obtained 307 amino acids with a molecular weight of 32.321 Kilo Daltons (KD) (Figure 2). To identify an appropriate plasmid for the expression of the designed fusion epitopic construct sequences in E.coli BL21,the pET28a+ plasmid was selected from the Addgene site (Watertown, USA). The MCS part of the plasmid contains 11 recognition sites for restriction endonuclease enzymes (REs). To ascertain the presence of these sites within the DNA sequence of the peptide construct, the MCS was subjected to analysis using the CLC and NEBCutter programs, developed by CLC (Redwood, USA) and NEBCutter (Ipswich, USA), respectively. It was determined that the sequence does not have any cutting sites for the REs part of the MCS plasmid pET28a+. In the subsequent step, the ORF Finder program was used to examine the presence of the start codon and stop codon in the DNA sequence, and found that this sequence lacked both the start and stop codons, exhibiting a single open reading frame (ORF). The final stage of the DNA sequence was placed inside the pET28a+ plasmid by the SnapGene program. NcoI and XhoI restriction endonuclease (RE)cutting sites were created at the 5' ends, respectively, followed by the addition of the sequence required for the His tag. 2.4. Preparation of Recombinant Plasmid and Clone in Bacteria The synthesis of fusion epitopic DNA sequences and clones in the pET28a+ plasmid was carried out by Biomatic (Lincoln, Canada). The bacterial strain BL21 E.coli was obtained from NEB (Ipswich, USA). The antibiotic Kanamycin which is required for plasmid transformation screening, was procured from Sigma-Aldrich (St. Louis, USA). The recombinant plasmid, prepared using a Thermo Scientific transformation kit (Waltham, USA), was introduced into E.coli and the Blue-White screening method was used using X-gal, IPTG, and Kanamycin (Merck, Germany) for the initial screening of transformed bacteria. The white colonies of transformed bacteria were isolated in a - culture medium containing Kanamycin. To confirm the presence of the recombinant plasmid in these bacteria, a colony PCR method was used using primers designed by the vector NTI program (Version 10, CA, USA) and synthesized by Arian Gene Gostar (Tehran, Iran).The primers used were ATGGCGTCTCTGCTGAC(forward) &CTCGAGCAGAGAAGAAGCAAC(reverse) .and the method used was colony PCR. 2.5. Expression, Purification and Quantitative Measurement of Fusion Epitopic Construct To express the fusion epitopic construct, 50 milliliters of Terrific broth culture medium was used to incubate 50 ml of E. coli BL21 bacteria containing a recombinant plasmid overnight at 37°C in a shaker incubator. Subsequently, 1 ml of the bacterial culture was added to another 200 ml of the other terrific broth culture medium and incubated in the 37°C shaker incubator. The following step was to measure the OD of the bacterial culture sample a wavelength of 600 nm at one-hour intervals. Once the OD value reached 0.5 to 0.8.IPTG was added to the culture medium inside the shaker incubator and incubation was continued up to 4 hours to allow the peptide expression. Finally, the bacterial culture was removed from the incubator and subjected to centrifugation at 10,000 rpm for 5 minutes at 4°C. The bacterial pellet was lysed using a lysis buffer solution containing Phenyl Methyl Sulfonyl Fluoride (PMSF), which inhibits proteases to extract the fusion epitopic construct. This was done using a Hielscher homogenizer (Teltow, Germany) and IKA sonication (Staufen, Germany). Subsequently, the samples were subjected to centrifugation the previously established conditions, and the resulting supernatant containing the extracted proteins was isolated and filtered through a 0.2-micron Millipore filter. The fusion epitopic construct was purified using a protein extraction kit with nickel columns (ABT Affinity His-Tag Ho Chi Minh, Vietnam). The purified fusion epitopic construct subjected to examination via Nanodrop (Thermo Scientific Waltham, USA) to check the extraction quality at wavelengths 340 and 280 nm. As for the extract in BCA (Bi Cinchoninic Acid) protein a quantitative measurement kit (Pars toss, Tehran, Iran) was used to measure the final peptide concentration. Then, the SDS-PAGE method was used to determine the molecular weight of the extracted peptide. Finally, the Western blot method was used to confirm of fusion epitopic construct with anti-His-tag antibody by DAB (Di Amino Benzidine) staining. 2.6. Immunization with a Fusion Epitopic Construct in the BALB/c Mice The 6-8 old week female BALB/c mice (Razi, Mashhad, Iran) were divided into two groups: a control group and an immunized group. Each of these groups consisted of six mice. On the day of immunization, 20 µg of the fusion epitopic construct was dissolved in 100 µl of sterile normal saline prepared with nonpyrogenic injectable distilled water and injected via the SC route into the upper hindlimb
muscles of the immunized group by an insulin syringe. The control group was administered mice of the were injected with only 100 µl of normal saline. Booster immunizations were performed 14 days after the first immunization. Three weeks after completion of the second immunization, both groups of mice were weighed and examined for any side effects at the injection sites. Then, the mice were euthanized by inhalation of high concentration of CO2 gas in a special cage and blood was collected from their heart using a 2 ml syringe. 2.7. Measurement of Total Serum IgG Antibody Levels After Fusion Epitopic Construct Immunization The total Mouse IgG kit (Cygnus Technology F049, NC, USA) was used to determine the total IgG antibody in the blood of mice after fusion epitopic peptide immunization. The kit has a detection accuracy of 0.3 ng/ml. A total of 50 µl of each test serum sample and standard control solution were utilized. The kit contains five dilutions of 0, 0.25, 1, 4 and 20 ng poured into each well. The procedure was conducted in accordance with the instructions provided in the kit ,and the results were read in two wavelengths (405 and 492 nm) using an ELISA reader (Biotek, Vermont, USA). The average absorption was then calculated at two wavelengths, and using the standard curve obtained from the control solution, the amount of total IgG antibodies in the serum of the mice was obtained in ng using the standard curve obtained from the control solution. 2.8. Statistical Analyses The statistical analysis was performed using the GraphPad Prism program (version 10, Boston, USA). An unpaired t-test was used to examine the meaningful difference between the immunized and control groups with a P value < 0.0001 was considered statitistically significant.
3.1. H5N1 Fusion Epitopic Construct Has the Right Size, Purity, Accuracy and Quantitative Measurement The result of the proprietary primer PCR colony result confirmed the DNA sequence of the fusion epitopic construct fragment with a length of 921 bp. This was evident from the presence of a band in the range between 900 bp and 1000 bp in all PCR samples. The SDS-PAGE of the purified fusion epitopic construct showed a band at approximately 32 KD, confirming the production of the fusion epitopic construct by bacteria. Also, the Western blot result of the purified fusion epitope construct demonstrated the presence of a specific band, indicative of successful binding between DAB and the anti His-tag antibody. The BCA quantitative measurement of the purified fusion epitopic construct peptide yielded a result of 0.455 mg/ml, which equates to 455 μg/ml (Figure 3). This indicates that the amount of fusion epitope construct peptide produced is 0.455 mg/ml equal , or 455 μg/ml (Figure 3). 3.2. SC Immunization with H5N1 Fusion Epitopic Construct in Mice Is Safe Without Any Weight Loss and Detrimental Side Effects Following the administration of the fusion epitopic construct to mice twice, no adverse effects were observed until the end of the experiment. No local complications were observed at the SC injection sites until the end of the experiment. The autopsy of the mice showed no evidence of bleeding or macroscopic lesions in the liver or spleen (data not shown). The weight of the mice remained relatively consistent throughout the immunization period (Table 2). 3.3. H51N1 Fusion Epitopic Construct Immunization Induces High IgG Levels in BALB/c Mice Following two rounds of immunization, blood samples were collected from the hearts of the mice seven weeks after the start of the experiment. The serum samples were then separated for analysis. An ELISA was performed to measure the total IgG levels in the serum samples of the immunized and control mice. The OD values were converted to nanograms (ng) in accordance with the instructions provided in the kit. The average IgG value in the control group was 1.143 ng/ml, while the average in the immunized group was 5.881 ng/ml. This represents a significant increase of more than five times the IgG antibody in the immunized group compared to the control group. The significant differences and normality of the results obtained from the two groups were calculated and analyzed using an unpaired t-test statistical method, with a and P value < 0.0001 (****), which was considered significant (Figure 4).
The World Health Organization (WHO) has indicated that the H5N1 virus may be the cause of a future influenza pandemic with high human casualties in the future (11). It is therefore vital that a new generation of vaccines with effective and protective features is developed as a matter of urgency in order to limit the number of casualties and infection rate caused by this virus (10, 11, 12). The high risks associated with of the H5N1 subtype make it challenging to develop a vaccine using cultivation methods in eggs and cell lines that require specialized protective equipment such as BSL3 (Bio Safety Level 3) laboratories (13). To address this challenge, the expression of viral immunogenic proteins in microorganisms, including bacteria, viruses, yeast, algae, plants and animals can be used to develop practical vaccine components (6, 14). The M2 protein of the influenza H5N1 virus is made of seven gene fragments and contains 97 amino acids. This protein is tetrameric and located on the surface of the lipid envelope of the virus. It consists of three parts: 1. Region N of the extracellular terminal (M2e-amino acids 2 to 24), 2. Region TM (amino acids 25 to 46), and 3. Region C is the intracellular terminal (amino acids 47 to 97). By creating an ion channel in the virus membrane, the M2 protein causes the ion (H+ or Proton) to enter the virion from the acidic space of the endosome and initiate the process of uncoating the influenza virus and entry of the ribonucleoprotein (RNP) of the virus into the host cell and initiate infection (4).
The humoral and cellular immunity of anti-M2e antibodies against influenza viruses is carried out through several mechanisms, including:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
1. Yamauchi Y. Influenza virus method and protocols. In: Walker JM, editors. School of cellular and molecular medicine, University of Bristol, Bristol, UK. New York: Humana press; USA. 2018. P. 1-22. 2. Herrera-Rodrigueza J, Meijerhofa T, Niestersa HG, Stjernholmb G, Hovdenb AO, Sørensena B, et al. A novel peptide-based vaccine candidate with protective efficacy against influenza A in a mouse model. Virology. 2018;515:21-28. 3. Swayne DE. Animal influenza. Exotic and emerging avian viral diseases research unit. Chennai: Wiley blachwell. India. 2017.P.3-30. 4. Howley PM, Knipe DM. Fields virology: Emerging viruses. In: Whelan S, editors. Department of immunology Harvard medical school. Philadelphia: Wolters Kluwer. USA. P.809-859. 5. Frutos AM, Price AM, Harker E, Reeves EL, Ahmad HM, Murugan V, et al. Interim Estimates of 2023–24 Seasonal Influenza Vaccine Effectiveness United States. Morbidity and Mortality Weekly Report. 2024;73(8):1-7. 6. Zhao G, Du L, Xiao W, Sun S, Lin Y, Chen M, et al. Induction of protection against divergent H5N1 influenza viruses using a recombinant fusion protein linking influenza M2e to Onchocerca volvulus activation associated protein-1 (ASP-1) adjuvant. Vaccine. 2010; 28: 7233–40. 7. Lim CML, Komarasamy TV, Adnan NAAB, Radhakrishnan AK, Balasubramaniam VRMT. Recent Advances, Approaches and Challenges in the Development of Universal Influenza Vaccines. Influenza and Other Respiratory Viruses. 2024;18:1-13. 8. Sheikh QM, Gatherer D, Reche PA, Flower DR. Towards the knowledge-based design of universal influenza epitope ensemble vaccines. Bioinformatics. 2016; 32(21): 3233-9. 9. Tutykhina I, Esmagambetov I, Bagaev A, Pichugin A, Lysenko A, Shcherbinin D, et al. Vaccination potential of B and T epitopeenriched NP and M2 against Influenza A viruses from different clades and hosts. P one. 2018:1-29. 10. Focosi D, Maggi F. Avian Influenza Virus A(H5Nx) and Prepandemic Candidate Vaccines: State of the Art. Molecular Sciences. 2024;25:1-16. 11. He J, Kam YW. Insights from Avian Influenza: A Review of Its Multifaceted Nature and Future Pandemic Preparedness. Viruses. 2024;16:1-14. 12. Faccin FC, Perez DR. Pandemic preparedness through vaccine development for avian influenza viruses. Human Vaccine & Immunotherapeutics. 2024;20(1):1-14. 13. Chinh CV, Quoc VP, Tan LH, Van DN, Quang TP, Van BL. Persistence of vaccine-induced antibodies to A/H5N1 at 30 months and 36 months after vaccination in Vietnam. Epi H. 2021;43:1-6. 14. Tan Y, He F, Kwang J. How can we develop universal H5N1 vaccines. Immunotherapy. 2015;1-4. 15. Simhadri VR, Dimitrova M, Mariano JL, Zenarruzabeitia O, Zhong W, Ozawa T, et al. A Human Anti-M2 Antibody Mediates Antibody-Dependent Cell-Mediated Cytotoxicity (ADCC) and Cytokine Secretion by Resting and Cytokine-Preactivated Natural Killer (NK) Cells. P one. 2015;1-13. 16. Gomes KB, Zhang YN, Lee YZ, Eldad M, Lim A, Ward G, et al. Single-Component Multilayered Self-Assembling Protein Nanoparticles Displaying Extracellular Domains of Matrix Protein 2 as a Pan-influenza A Vaccine. Acs nano. 2023;17:23545-67. 17. Liu TY, Hussein WM, Toth I, Skwarczynski M. Advances in Peptide-based Human Papillomavirus Therapeutic Vaccines. Current Topics in Medicinal Chemistry. 2012;12:1-12. 18. Coughlin MM, Beck AS, Bankamp B, Rota PA. Perspective on Global Measles Epidemiology and Control and the Role of Novel Vaccination Strategies. Viruses. 2017;9:1-13. 19. Vink P, Shiramoto M, Ogawa M, Eda M, Douha M, Heineman T, et al. Safety and immunogenicity of a Herpes Zoster subunit vaccine in Japanese population aged ≥50 years when administered subcutaneously vs. intramuscularly. Human Vaccine & Immunotherapeutics. 2017;13:3, 574-8. 20. Mytle N, Leyrer S, Inglefield JR, Harris AM, Hickey TE, Minang J, et al. Influenza Antigens NP and M2 Confer Cross Protection to BALB/c Mice against Lethal Challenge with H1N1, Pandemic H1N1 or H5N1 Influenza A Viruses. Viruses. 2021;13:1-13. 21. Kalaiyarasu S, Bhatia S, Mishra N, Kumar DS, Kumar M, Sood R, et al. Elicitation of Highly Pathogenic Avian Influenza H5N1 M2e and HA2-Specific Humoral and Cell-Mediated Immune Response in Chicken Following Immunization With Recombinant M2e–HA2 Fusion Protein. Frontiers in Veterinary Science. 2021 February 5;7:1-15. 22. Hendy DA, Amouzougan EA, Young IC, Bachelder EM, Ainslie KM. Nano/microparticle Formulations for Universal Influenza Vaccines. AAPS Journal. 2022;24:1-13. 23. Kostolansky F, Tomcikova K, Briestenska K, Mikusova M, Vareckova E. Universal anti-influenza vaccines based on viral HA2 and M2e antigens. Acta virologica. 2020;64:417-26. 24. Kim KH, Li Z, Bhatnagar N, Subbiah J, Park BR, Shin CH, et al. Universal protection against influenza viruses by multi-subtype neuraminidase and M2 ectodomain virus-like particle. PLOS Pathogens. 2022 August 25;1-23. 25. Subbiah J, Oh J, Kim KH, Shin CH, Park BR, Bhatnagar N, et al. A chimeric thermostable M2e and H3 stalk-based universal influenza A virus vaccine. NPG vaccine. 2022;7:68,1-15. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Statistics Article View: 1,291 PDF Download: 799 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||