| Mycologia Iranica | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Article 4, Volume 3, Issue 2, January 0, Pages 111-120 PDF (704.19 K) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| DOI: 10.22043/mi.2016.112566 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Full Text | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
INTRODUCTION Dieback of pistachio (Pistacia vera L.) is one of the most important, destructive and threatening diseases of Iran pistachio orchards. The disease affects different parts of the tree such as branch and trunk. Dieback of pistachios was first reported in 1987 in Iran (Aminaei 1987). Beside its plant pathogenic activity, it is also associated with many types of human infections (Abbas et al. 2009). Hyphomycosis disease in human caused by two species of Paecilomyces lilacinus and P. variotii (Houbraken et al. 2008). At this time, the majority of studies on phylogeny of Paecilomyces species using molecular markers have been performed on entomopathogenic species (Dalleau–Clouet et al. 2005; Luangsa–ard et al. 2004). Recently, researchers have attempted to find out more information about the relationships between the different species of Paecilomyces, especiallyinsect–pathogen species. Genetic similarities in unidentified isolates of P. fumosoroseus and some selected strains were observed using ITS and RAPD markers (Azevedo et al. 2000). Arbitrarily primed PCR and PCR with tRNA consensus primers have been used to analyse genetic variability among P. fumosoroseus isolates (Tigano–Milani et al. 1995). The conserved sequence of rDNA–ITS regions has been used for molecular phylogenetic analysis of fungi (Kiss 1997; Nilsson et al. 2008). Sequence variation within the ribosomal DNA region has been used extensively for the phylogenetic analysis of both closely related and distantly related organisms (White et al. 1990). This can also provide an alternative approach to RAPD–PCR and tRNA–PCR for both the estimation of genetic diversity and the determination of phylogenetic relationships. Furthermore, the fast–evolving ITS region has been found to be a powerful tool for characterization of most fungal bio–control agents (Avis et al. 2001). Ribosomal genes evolve cohesively within a single species and exhibit only limited sequence divergence between rDNA copies. In contrast, comparison between species showed normal levels of sequence divergence (Arnheim et al. 1980). There is not enough information about the genetic variability of this species in the literatures. The aim of the present study was to investigate the genetic diversity among P. variotii isolates of different geo–climatic regions from Kerman province, using ITS and RFLP analysis. MATERIALS AND METHODS Sampling Samples were collected from different pistachio farms of Kerman province in Iran during 2011–2012 (Fig. 1). Sampling area were divided to seven geographical zone based on GPS information (Table1). The infected branches showing necrosis symptom were cut, kept in nylon pockets and transferred immediately to the refrigerator at 20 °C.
Fig. 1. The location of sampling regions on map of Karman province, Iran. Sampling regions are indicated by black filled circle. Isolation and purification of isolates The small pieces from the central core of infected barks of pistachio branches were surface–sterilized with 3% chloramine T (Sigma Co., Germany) and were placed on PDA (potato dextrose agar; Merck, Germany) culture medium for fungal growth at 22–25 °C for one week (Ebrahimi et al. 2015). Purification of fungal isolates was conducted by the hyphal–tip method and fungal identification at the genus/species level was carried out by morphological criteria (Brown & Smith 1957; Hoog et al. 2000; Samson 1974). Out of 116 P. variotii isolates, 28 selected isolates were recovered from all sampling region (four isolates from each region) which showed that typical species characters were selected to assess genetic diversity for further analysis.
DNA extraction A piece of ten–day–old fungal colony on PDA medium was transferred to 100 mL Erlenmeyer flasks containing 200 mL of PDB liquid medium (Merck, Germany). The flasks were placed on a rotary shaker (120 rpm min–1) for eight days at 25 °C and then the mycelia were harvested by filtering. Total genomic DNA was extracted from dried mycelium using the CTAB method (Nicholson et al. 1997). Total DNA was quantified using a Scanodrop 200 (Analytik Jena, Germany) spectrophotometer and the concentration of DNA was adjusted to 25 ng.µL–1 for use in PCR assay. DNA quality was assessed by 1% agarose gel electrophoresis stained by ethidium bromide. Table 1. Code number, Location and geographic position calculated by GPS of Paecilomyces variotii isolates used in this study.
Primers TW81 (5′–GTTCCGTAGGTGAACCTG C–3′) and AB28 (5′–TATGCTTAAGTTCAGCGG GT–3′) were used to amplify the ITS–rDNA region (White et al., 1990). Amplification were carried out in volumes of 25 μL containing: 1 μL of genomic DNA (25 ng), 1.5 μL of 10×buffer PCR (100 mM Tris–HCl, 15 mM MgCl2, 500 mM KCl, pH 8), 1 μL of MgCl2 (50 mM), 0.25 μl of dNTPs (100 mM), PCR–RFLP analysis The PCR products were purified using the PCR purification kit (Genall, South Korea,) for the PCR–RFLP analysis. Thirteen restriction enzymes including EcoR I, Hpyf 3I, Hinf I, Msp I, Apa I, Mbo I, Pst I, Not I, Rsa I, Dra I, BamH I, Hind III, and Mse I (SinaClon, Iran) were used to digest ITS–rDNA PCR products. Ten units of each enzyme, with a total volume of 15 μL were used in the reaction. The reaction was incubated for 18 h at 37 °C. Genetic diversity ITS–RFLP patterns were used to estimate similarities among the isolates. Restriction–enzyme digests were used to generate ITS–RFLPs. For this purpose, each DNA band formed by the digestion in RFLP analysis was considered to be a character, and only the presence or absence of RFLPs fragments was recorded. A dendrogram was constructed from the resulting distance matrix using the Unweighted Pair Group Method with Arithmetic Mean Algorithms (UPGMA) and genetics similarity determined using Jaccard's similarity coefficient (Sneath & Sokal, 1973). The software PopGene 32 was used to perform the distance analysis (Kumar et al. 2008).ThePAUP version 0.4.0 beta program was used for phylogenetic analysis of the various data sets (Swofford, 2003). Genetic variations within and between populations was estimated by analysis of molecular variance (AMOVA) performed with GenALEX version 6.1. Sequencing Both strands of each PCR products were sequenced by PishgamBiotech Company (Tehran, Iran). DNA sequences were queried using the NCBI stand–alone BlastAll program (Altschul 1990) against the NCBI non–redundant (nr) protein reference library, Swissprot version 6, UniProt and UniRef100. Sequence similarities above 90% with an E value less than 1E–10 were considered as statistically significant positive matches. Deposited sequences were retrieved from GenBank. The obtained sequences were aligned with a rDNA–ITS sequence of P. variotti isolates in gene bank using the Clustal W program, version 1.81 (Thompson et al. 2002).
RESULTS Identification of fungal isolates All recovered fungal isolates from infected twigs were identified by morphological criteria using valid mycology keys. One hundred sixteen isolates out of 180 were identified as Paecilomyces variotii. After two weeks growth, the isolates showed a brown or yellow– brownish colour on the surface of solid medium. A powdery yellow–brownish colony with a high growth rate at 25 °C and 37 °C was observed on PDA medium. Single–celled and hyaline conidia were born in chains with the youngest cell at the base of conidiophores. The phialides were swollen at the base and gradually taper to a sharp point at the tip. To confirm morphological diagnosis, the sequences of five represented isolates from different geographic regions were queried against data base. Analysis of alignment showed a high similarity of our sequences (96–99%) with deposited sequences of P.variotii in geneBank (Table 2, Fig. 2). Polymorphism of ITS–RFLP patterns Amplification of the region from the 3´ end of the 18S rDNA to the 5´ end of the 28S of rDNA resulted in an approximately 600–800 base pair (bp) fragment (Fig. 2). The ITS1–ITS2 amplicons were subjected to digestion with thirteen different restriction enzymes. Seven out of the 13 restriction endonuclease (EcoR І, Hpyf 3І, Apa І, Hinf І, Mbo І, Msp І, showed restriction pattern. No restriction sites were found when DNA was treated with Rsa І, Not І, Pst І, BamH І and Hind ІІІ. The banding patterns obtained with restriction endonuclease digestion, the number and the size of the fragments from 28 P. variotii isolates are characterized in Table 3. Based on resulted patterns of digested PCR products, all isolates were divided into three distinct groups. The sixteen isolates from various graphic regions (Ravar, Sirjan, Rafsanjan and Kerman) were clustered in group 1 based on ITS–RFLP patterns. Group 2 consisted of 8 isolates originated from diverse geographic locations representing four isolates from Zarand, two isolates from Bardsir and two isolates from Tahroud origins and group 3 contain three isolates from two different geographical regions including Bardsir (2 isolates) and Tahroud (one isolates) isolates ( Table 3). The enzyme BamH1 digested the fragment, but showed no polymorphisms among isolates. The highest number of restricted fragment was obtained for the Aps I enzyme, whereas the EcoR I and Msp І showed the lowest digestion. The Mbo І enzyme revealed a higher variety and the Msp І enzyme showed a low diversity among isolates. The maximum number of nucleic acid band ranged from 45 – 325 was obtained for Aps I pattern (Table 3). The Mbo I and Msp I enzymes revealed the highest and lowest values for Hc (0.453 and 0.347 respectively. The highest (0.644) and lowest (0.525) Id values were obtained for Mbo I and Msp 1 (Table 4). Cluster analysis using NTSYSpc software (version 2.2) based on the Jaccard’s coefficient showed that all isolates were divided to nine separate groups with a high similarity value of 70%. Isolates were grouped into nine clusters designated from A to I. Isolates of group A–B and group D–E contain isolates from Zarand and Rafsanjan regions with similarity value of 66% and 50% respectively. Other isolates were placed in a distinct group (C, D, E, F, I) (Fig. 4).
Table 2. Similarity percentage of studied isolates of Paecilomyces variotii with deposited sequences in GeneBank
Analysis of molecular variance showed a high proportion of total variation is supported by variability (85%) among isolates and less proportionately (15%) within isolates (Table 5).
SUMS0303 TGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAA-GGATCATTACCGA 59 KUC5015 ------------TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAA-GGATCATTACCGA 47 BCC14365 -------------------------------------------GAA-GGATCATTACCGA 16 Z2 -----------------------GTTCCGTAGGTGAACCTGCGGAA-GGATCATTGCAGC 36 B3 -----------------------GTTCCGTAGGTGAACCTGCGGAA-GGATCGTAAACCT 36 K2 -----------------------GTTCCGTAGGTGAACCTGCGGAA-GGATCATTACCAC 36 X3 -----------------------GTTCCGTAGGTGAACCTGCGGAAAGGATCATTACCGA 37 R1 -----------------------GTTCCGTAGGTGAACCTGCGGAA-GGATCATTACCGA 36 Isolate15 --------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTACCGA 34 SCSGAF0038 ------------------------------------------------------TACCGG 6
SUMS0303 GTGAGGGTCC-CACGAGGCCCAACCTCCCATCCGTGTTG-AACTACACCTGTTGCTTCGG 117 KUC5015 GTGAGGGTCC-CACGAGGCCCAACCTCCCATCCGTGTTG-AACTACACCTGTTGCTTCGG 105 BCC14365 GTGAGGGTCC--ACGAGGCCCAACCTCCCATCCGTGTTG-AACTACACCTGTTGCTTCGG 73 Z2 GTGCGGGACC-CACGCAGATACACCCTCCACCCGTGTTATAACTACACCTGTTGCTTCGG 95 B3 GCGTGGGTCT-CATGAGTGACAATGCTGCATCCGTGTTG-AACTACACCTGTTGCTTCGG 94 K2 GGGCTGGTCCACGCAGAGAAGAACCTCCCATCCGTGTTG-AACTACACCTGTTGCTTCGG 95 X3 GTGAGGGTCA-CGCATATACCAACCTCCCATCCGTGTTG-AACTACACCTGTTGCTTCGG 95 R1 GTGAGGGTCC-CACGAGGCCCAACCTCCCATCCGTGTTGGAACTACACCTGTTGCTTCGG 95 Isolate15 GTGAGGGTCC-CTCGAGGCCCAACCTCCCATCCGTGTTG-AACTACACCTGTTGCTTCGG 92 SCSGAF0038 ATTAGA--TC-CACGAG--CTAACCTCC-ATCCGTGTTG-AACTACACCTGTTGCTTCGG 59
SUMS0303 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCTCCCGGGCCCGCGCCC 177 KUC5015 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCTCCCGGGTCCGCGCCC 165 BCC14365 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCCCCCGGGCCCGCGCTC 133 Z2 CGGGCCCGTCGAGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCCCCCGGGCCCGCGCCC 155 B3 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCCCCCGGGCCCGCGCCC 154 K2 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCCCCCGGGCCCGCGCCC 155 X3 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCCCCCGGGCCCGCGCCC 155 R1 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCCCCCGGGCCCGCGCCC 155 Isolate15 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCTCCCGGGCCCGCGCCC 152 SCSGAF0038 CGGGCCCGCCGTGGTTCACGCCCGGCCGCCGGGGGGCCTTGTGCCCCCGGGCCCGCGCCC 119
SUMS0303 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 237 KUC5015 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 225 BCC14365 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 193 Z2 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 215 B3 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 214 K2 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 215 X3 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 215 R1 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 215 Isolate15 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCATTA 212 SCSGAF0038 GCCGAAGACCCCTCGAACGCTGCCCTGAAGGTTGCCGTCTGAGTATAAAATCAATCGTTA 179
SUMS0303 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 297 KUC5015 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 285 BCC14365 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 253 Z2 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 275 B3 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 274 K2 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 275 X3 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 275 R1 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 275 Isolate15 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 272 SCSGAF0038 AAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT 239
SUMS0303 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 357 KUC5015 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 345 BCC14365 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 313 Z2 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 335 B3 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 334 K2 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 335 X3 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 335 R1 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 335 Isolate15 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 332 SCSGAF0038 AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC 299
Fig. 2. A part of sequence alignment showing high similarity between the studied sequences of Paecilomyces variotii isolates and deposited sequences of this specie in GeneBank.
Table 3. Patterns within the Paecilomyces variotii rDNA–ITS–rDNA region after digestion with EcoR І, Hpyf 3 І, Apa І, Hinf І, Mbo І, Msp І, Mse І restriction endonucleases.
Table 4. Genetic diversity indices of Paecilomyces variotii isolates.
Na: Number of different alleles; Ne: Number of effective alleles; He: Nei's Unbiased Expected Heterozygosity. Id: Shannon Index
Fig. 3. ITS–RFLP pattern of represented Paecilomyces variotti isolates using restriction enzymes. Apa І (a); Mbo I (b); Mse I (c) and Hpyf3 I (d). Lin 1: R3; Line 2; R4; Line 3:K1; Line 4: K2; Line 5: K3; Line 6: K4; Line 7: B1; Line 8: B2; Line 9: B3; Line 10: B4; Line 11: T1; Line 12: T2; Line 13: T3; Line: 14:T4; wm, Molecular sizes in Kilobases are indicated on the right and left; Un, Negative control.
Fig. 4. Dendrogram constructed from analysis of DNA fragments 28 Paecilomyces variotii isolates amplified by PCR–RFLPP. The matrix was created with the Jacard similarity coefficient, and clustering was performed with UPGMA algorithm.
Table 5. Analysis of molecular variance of P. variotii isolates.
Discussion The genus Paecilomyces represents a wide spread species reported as a pathogen of many different insects, plants and human. This genus has been divided in two sections: Paecilomyces and Isarioidea (Samson 1974). Classification of the genus Paecilomyces was based on morphological characteristics, such as conidial and chain of conidiophores form, however was often highly subjective and lead to obscure identifications at the level of species (D'Alessandro et al., 2014). Using molecular markers such as ITS– rDNA, B–tubulin gene and the elongation factor 1–alpha (EF1–a) combined to morphological criteria have been used for the molecular characterization at the level of species (Kis e al., 1997; Tanabe et al., 2004; Rostami et al., 2015(. In this study, we firstly isolated different fungal genera from infected pistachio trees included Paecilomyces، Stemphyllium, Alternaria, Nattrasia, Bipolaris, Trichoderma, Chaetomium, Fusarium and Cytospora. Of 180 fungal isolates, 166 isolates were morphologically identified as Paecilomyes varioti species. Secondly, the genetic diversity of some selected isolates from different regions sampling was assayed to illustrate the genetic relation between different populations. Analysis of ITS–RFLP patterns revealed a high level of polymorphism within isolates morphologically classed as Paecilomyces variotii. The analysis of ITS–RFLP profiles generated by restriction endonucleases enzymes enabled a clustering of Paecilomyces variotii isolates. Furthermore, the sequence data and the resulting phylogenetic dendrogram using the maximum of parsimony method strongly supported the conclusions of the ITS–RFLP analysis (data non–showed). Fargus et al. (2002) found that Hae III alone could be used in polymorphism detection and discrimination of all isolates of Paecilomyces spp, P. fumosoroseus and P. tenuipes; however, in our study this enzyme did not allow to restrict genome of studied isolates. The patterns within the rDNA–ITS region of P. variotii after digestion with seven enzymes showed different restricted–fragment ranges. For the EcoR I and Msp I enzymes, we observed only one band, while other enzymes were able to restrict PCR products with more than one band (Table 3).The analysis of ITS–RFLP profiles generated by a limited number of endonucleases enabled a clustering of P. variotii isolates. ITS–RFLP and RAPD marker have been used to molecular characterization of 7 Paecilomyces fumosoroseus, 5 Paecilomyces sp. and 5 Paecilomyces tenuipes isolates from different countries (Azevedo et al., 2000). Molecular analysis showed that similarity among five unidentified isolates and strains of P. fumosoroseus was higher than other reference species as P. tenuipes. These results were expected because similar isolates were isolatedfrom the same pathogenesis phase in studied area. Our results are in agreement with those showing a closely related genetic similarity among isolates from same geographical regions. In this study, the amplified band resulting from the PCR was determined in 600 base pair (bp) long and as a single band. Our result is approximately in accordance with the results of Fargus et al. (2002), who showed that the multiplication of the same fragment in P. fumosoroseus isolates in the range of 670 bp produced a single band. Amplication of RDNA–ITSregions was done by using the same primers in study ofFargus et al. (2002). Genetic variability within 48 P. fumosoroseus isolates collected from different geographical origins was evaluated using rDNA–ITS marker. Genetic variability among Paecilomyces fumosoroseus isolates from various geographical and host insect origins based on the rDNA–ITS regions showed a high level of polymorphism within the P. fumosoroseus isolates (Fargues et al., 2002). The genetic diversity of 20 isolates of P. variotii in Kerman province was investigated based on pathogenicity tests, sampling area, and genetic diversity using microsatellite marker (SSR) and the results, showed that there is no special relationship between the genetic groups and origin of the isolates (Ebrahimi & Sabbagh, 2012). Our results are not in concordance with these results. This disagreement could be caused by the different markers used and the lack of information on the whole genome of fungi genera. DNA restriction fragment polymorphispm (RFLP) has been widely used in human and some plant genetic (Michelmore &Hulbert, 1987) and is the most common DNA technique to define multilocus genotypes for population studies of fungi (Rosendahl & Taylor, 1997). For the first time, study of population structure of Mycosphaerella was thoroughly done by McDonald and Martinez (1990). Their results encouraged other researchers to use of RFLP in thorough studies of other plant pathogenic fungi, such as Fusarium (Gordon et al., 1992), Sclerotinia (Kohn 1995), and Crypphonectria (Milgroom et al., 1996). Using molecular marker; PCR–RFLP and RAPD to genetic diversity study of some isolates of Macrophomina phaseolina showed that RAPD marker is more efficient than RFLP marker (Bakhshi et al., 2010). However, investigation of genetic diversity of Macrophomina phaseolina isolatescausal agent of root rot of cluster bean by Purkayastha et al. (2008) showed that RFLP marker is an enforceable marker to assay genetic diversity in these isolates. Occurrence of parasexual phenomen could increase reliability of this marker to study of genetic variety in fungi with this phenomen. Dispersion of fungi units to new ecological niches could influence biological cycles and adaptation to new hosts. In entomopathogenic Paecilomyces, it has been suggested that the mobility of dispersion units (spores) has a major influence on the life strategy of species of this genera; so host range, geographical distribution and genetic variability deriving could be affected (Oborník et al., 2000). Our results also suggest no relationship between genetic diversity and transmittance of fungal isolates and the distance of different geographical regions of Kerman province. In other works, increasing or decreasing the distance between two regions did not influence the similarity rate or genetic diversity of the studied isolates (Ebrahimi et al., 2015). The elongation factor 1–alpha (EF1–a) and ITS1–5.8S–ITS2 regions have been used to molecular phylogeny study of Isaria spp. strains (Ascomycota: Hypocreales). Based on obtained results, these markers were found to be powerful tools to improve the characterization, identification, and phylogenetic relationship of the Isaria strains and other entomopathogenic fungi (D'Alessandro et al., 2011). Based on our results, it can be concluded that beside of using ITS –RFLP marker for molecular phylogeny and genetic diversity studies, diagnostics of group level using these marker could be easily developed for epidemiological and ecological studies of distantly related isolates of P. variotii, as has been done for P. fumosoroseus isolates (Fargues et al., 2002). High genetic diversity of isolates from different region could be resulted to increase risk of compatibility of isolates to change of environmental condition and so, affect the disease controlling methods. Knowledge of structural genetics of plant pathogenic fungal will be a useful tool for plant breeding programs and prevent of new isolates from other regions or countries. Regarding to prevalent of Dieback disease of pistachio in Iran, and little information about structural genetic of this fungus, we propose a range–wide genetic assessment of Paecilomyces species in different pistachio cultured zones. The future studies could be performed to develop new molecular markers to detect this fungus in field. ACKNOWLEDGEMENTS This work was done in institute of plant biotechnology in university of Zabol, Iran. Here, we thank Mrs. Hamideh Khajeh to help us for technical support. Authors declare that the experiments comply with the current laws of Iranian ministry of Science, Research and Technology. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Abbas SQ, Maan A, Iqbql J, Niaz M. 2009. A Report of Paecilomyces variotti on Human from Pakistan. Pakistan Journal of Botany 41: 467–472.
Aminaee MM, Ershad D. 1987. Die–back of young shoots of pistachio trees in Kerman province. Proceeding of 11th Plant protection Congress., Iran, Rasht, Iran, Pp. 216.
Arnheim N, Seperack P, Banerji J, Lang RB, Miesfeld R, Marcu KB. 1980. Mouse rDNA nontranscribed spacer sequences are found flanking immunoglobulin genes and elsewhere throughout the genome. Cell 22: 179–185.
Avis TJ, Hamelin RC, Bélanger RR. 2001. Approaches to molecular characterization of fungal biocontrol agents: some case studies. Canadian Journal of Plant Pathology 23: 8–12.
Azevedo A, Furlaneto MC, Sosa–Gómez DR, Fungaro MHP. 2000. Molecular characterization of Paecilomyces fumosoroseus (Deuteromycotina: Hyphomycetes) isolates. Scientia Agricola 57:729–732.
Brown HS, Smith G. 1957. The Genus Paecilomyces Bainier and its Perfect Stage Byssochlamys Westllng. Transactions of the British Mycological Society 40:17–59.
Milgroom M, Lipari S. 1995. Spatial analysis of nuclear and mitochondrial RFLP genotypes in populations of the chestnut blight fungus, Cryphonectria parasitica. Molecular Ecology. 4: 633–642.
D'Alessandro C, Padin S, Urrutia M, López Lastra C. 2011. Interaction of fungicides with the entomopathogenic fungus Isaria fumosorosea. Biocontrol Science and Technology 21:189–197
D'Alessandro CP, Jones LR, Humber RA, López Lastra CC, Sosa‐Gomez DR. 2014. Characterization and phylogeny of Isaria spp. strains (Ascomycota: Hypocreales) using ITS1‐5.8 S‐ITS2 and elongation factor 1‐alpha sequences. Journal of basic microbiology 54 (S1).
Dalleau–Clouet C, Gauthier N, Risterucci AM, Bon M, Fargues J. 2005. Isolation and characterization of microsatellite loci from the entomopathogenic hyphomycete, Paecilomyces fumosoroseus. Molecular Ecology Notes 5: 496–498.
Ebrahimi S, Sabbagh SK. 2012. Study on genetic diversity and Pathogenic Progression of Paecilomycesvariotii isolates in Kerman province, University of Zabol, Zabol. pp. 98.
Ebrahimi S, Sabbagh SK, Aminaei M. 2015. Genetic diversity of Paecilomyces variotii isolates by SSR marker in Kerman province, Iran. Mycologia Iranica 2: 45–38.
Fargues J, Bon M–C, Manguin S, Couteaudier Y. 2002. Genetic variability among Paecilomyces fumosoroseus isolates from various geographical and host insect origins based on the rDNA–ITS regions. Mycological research 106: 1066–1074.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution: 783–791.
Gordon T, Okamoto D, Milgroom M. 1992. The structure and interrelationship of fungal populations in native and cultivated soils. Molecular Ecology. 1: 241–249.
Hoog GS, Guarro J, Gene J, Figueras MJ. 2000. Atlas of Clinical Fungi. Centralburea voor shimmelculture Utrecht, The Netherlands:Pp. 794–811.
Houbraken J, Varga J, Rico–Munoz E, Johnson S, Samson RA. 2008. Sexual reproduction as the cause of heat resistance in the food spoilage fungus Byssochlamys spectabilis (anamorph Paecilomyces variotii). Applied and environmental microbiology 74: 1613–1619.
Kiss L. 1997. Genetic diversity in Ampelomyces isolates, hyperparasites of powdery mildew fungi, inferred from RFLP analysis of the rDNA ITS region. Mycological research 101: 1073–1080.
Kohn L, 1995. The clonal dynamic in wild and agricultural plant–pathogen populations. Canadian journal of botany. 73: 1231–1240.
Kumar S, Nei M, Dudley J, Tamura K. 2008. MEGA: a biologist–centric software for evolutionary analysis of DNA and protein sequences. Briefings in bioinformatics 9: 299–306.
Luangsa–ard JJ, Hywel–Jones NL, Samson RA. 2004. The polyphyletic nature of Paecilomyces sensu lato based on 18S–generated rDNA phylogeny. Mycologia 96: 773–780.
Michelmore R, and Hulbert S. 1987. Molecular markers for genetic analysis of phytopathogenic fungi. Annual Review of Phytopathology. 25: 383–404.
Nicholson P, Rezanoor H, Simpson D, Joyce D. 1997. Differentiation and quantification of the cereal eyespot fungi Tapesia yallundae and Tapesia acuformis using a PCR assay. Plant Pathology 46: 842–856.
Nilsson RH, Kristiansson E, Ryberg M, Hallenberg N, Larsson K–H. 2008. Intraspecific ITS variability in the kingdom Fungi as expressed in the international sequence databases and its implications for molecular species identification. Evolutionary bioinformatics online 4: 193.
Oborník M, Klíc M, Zizka L. 2000. Genetic variability and phylogeny inferred from random amplified polymorphic DNA data reflect life strategy of entomopathogenic fungi. Canadian Journal of Botany 78: 1150–1155.
Purkayastha S. 2005. Race identification of Macrophomina Phaseolina, Causal agent of root rot of cluster bean using molecular markers. Ph. D. dissertation. Guru Jambheshwar University, Hisar, India.
Rostami F, Khosravi Moghaddam F, Sabbagh SK, Saeidi S. 2015. Comparison of PCR–RFLP Based on Ribosomal Regions and SSR Markers in Genetic Diversity of Pistachio Die–Back Caused by Paecilomyces variotii Gene Cell Tissue. 2: e24340.
Samson RA. 1974. Paecilomyces and some allied Hyphomycetes. Studies in Mycology 6: 1–119.
Sneath P, Sokal R. 1973. Numerical Taxonomy. Freeman. SanFrancisco: W. H. Freeman and Company.: 573.
Swofford DL. 2003. "PAUP* ver 4.0. b10." Phylogenetic Analysis Using Parsimony and Other Methods. Sunderland, MA: Sinauer Associates, Sunderland.
Thompson JD, Gibson T, Higgins DG. 2002. Multiple sequence alignment using ClustalW and ClustalX. Current protocols in bioinformatics:2.3. 1–2.3. 22.
Tigano–Milani MS, Honeycutt RJ, Lacey LA, Assis R, McClelland M, Sobral BW. 1995. Genetic variability of Paecilomyces fumosoroseus isolates revealed by molecular markers. Journal of Invertebrate Pathology 65: 274–282.
Tanabe Y, Saikaza M, Watanabe MM, Sugiyama J. 2004. Molecular phylogeny of Zygomycota based on EF–1 [alpha] and RPB1 sequences: limitations and utility of alternative markers to rDNA Molecular Phylogenetics and Evolution 30: 438–449.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18: 315–322. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Statistics Article View: 1,055 PDF Download: 651 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||